Hmgcs2^em1Hirm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hmgcs2^em1Hirm
• Name: 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2; endonuclease-mediated mutation 1, Hiroshi Maegawa
• MGI ID: MGI:6471013
• Synonyms: Hmgcs2^-
• Gene: Hmgcs2 Location: Chr3:98187751-98218054 bp, + strand Genetic Position: Chr3, 42.74 cM
• Alliance: Hmgcs2^em1Hirm page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 2 was targeted with sgRNAs (TGGAACGCACAAAGCTGCCG and GTGCCTGCAGTGGTACAGA) using CRISPR/Cas9 technology, resulting in a 38 bp deletion (TGACAGTGGTACAGAGGCTGATGGAACGCACAAAGCTG) in exon 2. (J:296610)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Hmgcs2 Mutation: 36 strains or lines available

References

• Original: J:296610 Tomita I, et al., SGLT2 Inhibition Mediates Protection from Diabetic Kidney Disease by Promoting Ketone Body-Induced mTORC1 Inhibition. Cell Metab. 2020 Sep 1;32(3):404-419.e6
• All: 2 reference(s)