Trem2^em1Aduci
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trem2^em1Aduci
• Name: triggering receptor expressed on myeloid cells 2; endonuclease-mediated mutation 1, Frank LaFerla
• MGI ID: MGI:6470973
• Synonyms: Trem2^R47H, Trem2*R47H^NSS, Trem2^{R47H NSS}
• Gene: Trem2 Location: Chr17:48653429-48659304 bp, + strand Genetic Position: Chr17, 23.99 cM, cytoband C
• Alliance: Trem2^em1Aduci page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Guide RNAs (gaagcactgggggagacgca and gtacatgacaccctcaagga) are designed to create a guanine to adenine missense mutation, resulting in an arginine to histidine change at amino acid 47 (R47H). This mutation R47H is homologous to the human R47H SNP shown to correlate with increased risk of late-onset Alzheimer's disease. Ten silent DNA mutations were also introduced. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Trem2 Mutation: 69 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 2 reference(s)