About   Help   FAQ
Lbrem1Mad
Endonuclease-mediated Allele Detail
Summary
Symbol: Lbrem1Mad
Name: lamin B receptor; endonuclease-mediated mutation 1, Michael A Dyer
MGI ID: MGI:6469611
Synonyms: LbrLox
Gene: Lbr  Location: Chr1:181642880-181669966 bp, - strand  Genetic Position: Chr1, 84.89 cM
Alliance: Lbrem1Mad page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready)
Mutation:    Insertion
 
Mutation detailsCRISPR/cas9 endonuclease-mediated genome editing was used with sgRNAs (GGAACUUUAUUUGGATCAGG and GGUUCCUUAGGCUCUUGUGA) and two ssODN templates to flank exon 10 with loxP sites. (J:282593)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Lbr Mutation:  55 strains or lines available
References
Original:  J:282593 Norrie JL, et al., Nucleome Dynamics during Retinal Development. Neuron. 2019 Nov 6;104(3):512-528.e11
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory