Rr272em1Mad
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr272em1Mad |
| Name: |
regulatory region 272; endonuclease-mediated mutation 1, Michael A Dyer |
| MGI ID: |
MGI:6469562 |
| Synonyms: |
Vsx2 CRC-SEdelta, Vsx2em1Mad, Vsx2-SEdelta |
| Gene: |
Rr272 Location: Chr12:84570408-84611689 bp Genetic Position: Chr12, Syntenic
|
| Alliance: |
Rr272em1Mad page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Intergenic deletion
|
|
|
Rr272em1Mad involves 6 genes/genome features (Lin52, Rr274, Rr275 ...)
View all
|
| |
|
Mutation details: This Vsx2 bipolar neuron-specific core regulatory circuit super enhancer (CRC-SE) was targeted with sgRNAs (targeting GCAGGCCATGTGCTCGTCGA and CAGGGTGCAGGCTGACAACG) using CRISPR/Cas9 technology, resulting in slightly different deletions in three independent lines: chr12:84579812-84611543 (Vsx2-3-3), 84579815-84611547 (Vsx2-59-12) and 84579815-84611546 (Vsx2-23-3); all coordinates from build GRCm39. The deletions involve super-enhancer component enhancers Rr274, Rr275 and Rr276 (which contains Rr261800 and Rr268660), but not Rr273, and an alternative exon 1 of Lin52.
(J:282593)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr272 Mutation: |
0 strains or lines available
|
|
| Original: |
J:282593 Norrie JL, et al., Nucleome Dynamics during Retinal Development. Neuron. 2019 Nov 6;104(3):512-528.e11 |
| All: |
4 reference(s) |
|