Bicral^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Bicral^em1(IMPC)J
• Name: BRD4 interacting chromatin remodeling complex associated protein like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6468335
• Gene: Bicral Location: Chr17:47109046-47169408 bp, - strand Genetic Position: Chr17, 22.9 cM
• Alliance: Bicral^em1(IMPC)J page
• IMPC: Bicral gene page

Mutation origin

• Strain of Origin: Not Applicable
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCTTGTGACTGACAGGAGA and ATTTTTAGCTCACCAAGCAA, which resulted in a 532 bp deletion beginning at Chromosome 17 position 46,829,784 bp and ending after 46,830,315 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000424961, ENSMUSE00000424956 (exons 2,3) and 414 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 14 and early truncation 10 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Bicral Mutation: 319 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)