About   Help   FAQ
Taf1aem1(IMPC)Bay
Endonuclease-mediated Allele Detail
Summary
Symbol: Taf1aem1(IMPC)Bay
Name: TATA-box binding protein associated factor, RNA polymerase I, A; endonuclease-mediated mutation 1, Baylor College of Medicine
MGI ID: MGI:6467480
Synonyms: Taf1a-
Gene: Taf1a  Location: Chr1:183170325-183191020 bp, + strand  Genetic Position: Chr1, Syntenic
Alliance: Taf1aem1(IMPC)Bay page
IMPC: Taf1a gene page
Taf1aem1(IMPC)Bay/Taf1aem1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E3.5 as morulas but not at E7.5. Embryos fail to hatch from the zona pellucida and die after 3 days in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences ACCATAACGTCAAATATTTC and TTGCTTTAAGTCAGTGGGCC that targeted exon(s) ENSMUSE00000628381.2. This resulted in deletion(s) of 626 bp (location: Chr1:183177128-183177753; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Taf1a Mutation:  11 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory