Bicraem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Bicraem1(IMPC)J |
Name: |
BRD4 interacting chromatin remodeling complex associated protein; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6460366 |
Gene: |
Bicra Location: Chr7:15704597-15781846 bp, - strand Genetic Position: Chr7, 8.67 cM
|
Alliance: |
Bicraem1(IMPC)J page
|
IMPC: |
Bicra gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AACTGGAGATGGAACCCCGG and ACTTCAATCATCCCACCCAA, which resulted in a 3648 bp deletion beginning at Chromosome 7 position 15,976,865 bp and ending after 15,980,512 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000599921, ENSMUSE00000599920, ENSMUSE00000677013, and ENSMUSE00000677012 (exons 7, 8, 9, and 10) and 2659 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 763 and early truncation 24 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|