About   Help   FAQ
Thap12em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Thap12em1(IMPC)J
Name: THAP domain containing 12; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6460295
Gene: Thap12  Location: Chr7:98352310-98367269 bp, + strand  Genetic Position: Chr7, 53.86 cM, cytoband F1
Alliance: Thap12em1(IMPC)J page
IMPC: Thap12 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTTGTTAATGTTCTATTAG and CCTTGTATATTTTCTTAAAA, which resulted in a 3412 bp deletion beginning at Chromosome 7 position 98714706 bp and ending after 98718117 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000265800 (exon 5) and 331 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 118 and early truncation 2 amino acids later. (J:188991, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Thap12 Mutation:  38 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/16/2026
MGI 6.24
The Jackson Laboratory