Gaaem1Jhng
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Gaaem1Jhng |
| Name: |
glucosidase, alpha, acid; endonuclease-mediated mutation 1, Jeffrey Huang |
| MGI ID: |
MGI:6454667 |
| Synonyms: |
Gaac.1826dupA |
| Gene: |
Gaa Location: Chr11:119158789-119176284 bp, + strand Genetic Position: Chr11, 83.35 cM, cytoband D-E
|
| Alliance: |
Gaaem1Jhng page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: Guide RNAs (GTACGCTGGTCACTGGACAG and CTGTCCAGTGACCAGCGTAC) are designed to insert an extra adenine at position 1826 (c.1826dupA), resulting in a tyrosine change to a premature stop codon at amino acid 609 (Tyr609*). This mutation results in a truncated protein as seen in patients with Infantile Onset Pompe Disease (IOPD). Silent protospacer adjacent motif (PAM) site mutations (GaaA>, GaaA>) and a gRNA seed region mutation (GaaT>) were also introduced to prevent gRNA editing of the donor template.
(J:294027)
|
|
|
|
|
| Original: |
J:294027 Huang JY, et al., CRISPR-Cas9 generated Pompe knock-in murine model exhibits early-onset hypertrophic cardiomyopathy and skeletal muscle weakness. Sci Rep. 2020 Jun 25;10(1):10321 |
| All: |
1 reference(s) |
|