About   Help   FAQ
Gaaem1Jhng
Endonuclease-mediated Allele Detail
Summary
Symbol: Gaaem1Jhng
Name: glucosidase, alpha, acid; endonuclease-mediated mutation 1, Jeffrey Huang
MGI ID: MGI:6454667
Synonyms: Gaac.1826dupA
Gene: Gaa  Location: Chr11:119158789-119176284 bp, + strand  Genetic Position: Chr11, 83.35 cM, cytoband D-E
Alliance: Gaaem1Jhng page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsGuide RNAs (GTACGCTGGTCACTGGACAG and CTGTCCAGTGACCAGCGTAC) are designed to insert an extra adenine at position 1826 (c.1826dupA), resulting in a tyrosine change to a premature stop codon at amino acid 609 (Tyr609*). This mutation results in a truncated protein as seen in patients with Infantile Onset Pompe Disease (IOPD). Silent protospacer adjacent motif (PAM) site mutations (GaaA>, GaaA>) and a gRNA seed region mutation (GaaT>) were also introduced to prevent gRNA editing of the donor template. (J:294027)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Gaa Mutation:  57 strains or lines available
References
Original:  J:294027 Huang JY, et al., CRISPR-Cas9 generated Pompe knock-in murine model exhibits early-onset hypertrophic cardiomyopathy and skeletal muscle weakness. Sci Rep. 2020 Jun 25;10(1):10321
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory