About   Help   FAQ
Irf5em1(IMPC)Bay
Endonuclease-mediated Allele Detail
Summary
Symbol: Irf5em1(IMPC)Bay
Name: interferon regulatory factor 5; endonuclease-mediated mutation 1, Baylor College of Medicine
MGI ID: MGI:6453611
Gene: Irf5  Location: Chr6:29526624-29541870 bp, + strand  Genetic Position: Chr6, 12.36 cM
Alliance: Irf5em1(IMPC)Bay page
IMPC: Irf5 gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Single point mutation
 
Mutation detailsThis allele from IMPC was generated at Baylor College of Medicine by injecting CAS9 Protein and the guide sequence CCCTCGGGACATGCCACCTCAGC, which resulted in a Point Mutation allele. (J:265051, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Irf5 Mutation:  30 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory