About   Help   FAQ
Setbp1em2Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Setbp1em2Lutzy
Name: SET binding protein 1; endonuclease-mediated mutation 2, Cathy Lutz
MGI ID: MGI:6452200
Synonyms: Setbp1S858R
Gene: Setbp1  Location: Chr18:78793595-79152606 bp, - strand  Genetic Position: Chr18, 52.67 cM, cytoband E3
Alliance: Setbp1em2Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutations:    Insertion, Nucleotide substitutions
 
Mutation detailsCRISPR/Cas9 genome editing is used to insert a S858R point mutation (AGC to AGG on the sense strand) using guide RNA [sense strand; GAGACTATCCCGAGCGACAG] in combination with stranded oligonucleotide donor DNAs [antisense strand; GGAACAGAAGTCGAAAGAGTACCTCCGCCGGGATTCTGAACTCTTCTCTGCTTGGTCGGAGGTGCTGTTGTTGTCTGTCCCGATGCCACTGTCCCTCGGGATAGTCTCCTCGCTGTGGGACTCACTC]. The S858R point mutation associated with Schinzel-Giedion midface retraction syndrome, and Mental retardation, autosomal dominant 29. (J:101977)
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Setbp1 Mutation:  91 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory