Ttc5em1(IMPC)Rbrc
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ttc5em1(IMPC)Rbrc |
| Name: |
tetratricopeptide repeat domain 5; endonuclease-mediated mutation 1, RIKEN BioResource Center |
| MGI ID: |
MGI:6452192 |
| Gene: |
Ttc5 Location: Chr14:51002872-51022976 bp, - strand Genetic Position: Chr14, 26.24 cM
|
| Alliance: |
Ttc5em1(IMPC)Rbrc page
|
| IMPC: |
Ttc5 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at RIKEN BioResource Research Center using Cas9 and guides with spacer sequences ACCAGCAAGCAGATTGCTAC and TAAATCACAGGACACGGCCC that targeted exon(s) ENSMUSE00000121425.4 ENSMUSE00000560266.2 ENSMUSE00000560267.2 ENSMUSE00001429553.2 ENSMUSE00002034507.1 ENSMUSE00002034518.1 ENSMUSE00002034520.1 ENSMUSE00002034537.1 ENSMUSE00002034543.1 ENSMUSE00002034552.1 ENSMUSE00002106208.1. This resulted in deletion(s) of 3401 bp (location: Chr14:51012311-51015711; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Ttc5 Mutation: |
23 strains or lines available
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
4 reference(s) |
|