Agxt2^{em1(IMPC)Hmgu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Agxt2^{em1(IMPC)Hmgu}
• Name: alanine-glyoxylate aminotransferase 2; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
• MGI ID: MGI:6450144
• Gene: Agxt2 Location: Chr15:10358618-10410239 bp, + strand Genetic Position: Chr15, 5.35 cM
• Alliance: Agxt2^{em1(IMPC)Hmgu} page
• IMPC: Agxt2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Helmholtz-Zentrum Muenchen using Cas9 and guides with spacer sequences CAGACTTGATTCTGTACTTA, GAGAACTGCTACATCCGTGA, GCCAGCCATTGATTTAGTTT, and TCACGTGACACTGGATTCAA that targeted exon(s) ENSMUSE00000563597.3 ENSMUSE00000793114.2 ENSMUSE00001868339.1 ENSMUSE00002144875.1 ENSMUSE00002144876.1. This resulted in deletion(s) of 969 bp (location: Chr15:10373380-10374348; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Agxt2 Mutation: 34 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)