About   Help   FAQ
Ten1em1(IMPC)Hmgu
Endonuclease-mediated Allele Detail
Summary
Symbol: Ten1em1(IMPC)Hmgu
Name: TEN1 telomerase capping complex subunit; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
MGI ID: MGI:6449028
Gene: Ten1  Location: Chr11:116089681-116106144 bp, + strand  Genetic Position: Chr11, 81.0 cM, cytoband E2
Alliance: Ten1em1(IMPC)Hmgu page
IMPC: Ten1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Helmholtz-Zentrum Muenchen by injecting CAS9 Protein and 2 guide sequences CCTATCCGTATGGTAGTGAGAAC, CCATACGCTGTGTTCGGATCTGT, which resulted in an Exon Deletion. Sequencing of the RNA quality control product predicted the first 30 amino acids to be translated followed by a frameshift and a premature stop after 87 amino acids. Major parts of exon 3 were deleted, as verified by Sanger sequencing. RT-qPCR analysis confirmed the absence of mRNA transcripts in the cerebrum, cerebellum, liver, lung, and skin of homozygous mutant mice. (J:265051, J:365069)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Structures Affected by this Mutation: 21 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ten1 Mutation:  11 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory