Il1rap^{em1(IMPC)Ccpcz}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Il1rap^{em1(IMPC)Ccpcz}
• Name: interleukin 1 receptor accessory protein; endonuclease-mediated mutation 1, Institute of Molecular Genetics
• MGI ID: MGI:6442551
• Gene: Il1rap Location: Chr16:26400454-26548867 bp, + strand Genetic Position: Chr16, 18.21 cM, cytoband B2
• Alliance: Il1rap^{em1(IMPC)Ccpcz} page
• IMPC: Il1rap gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Czech centre for Phenogenomics by injecting CAS9 Protein and 2 guide sequences GACTCTCACGGACTATCCACAGG, CCGATAGTGTTCTAAATGAACGC, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Il1rap Mutation: 54 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 1 reference(s)