Kitem1(IMPC)Ccpcz
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Kitem1(IMPC)Ccpcz |
| Name: |
Kit proto-oncogene receptor tyrosine kinase; endonuclease-mediated mutation 1, Institute of Molecular Genetics |
| MGI ID: |
MGI:6442540 |
| Gene: |
Kit Location: Chr5:75735647-75817382 bp, + strand Genetic Position: Chr5, 39.55 cM
|
| Alliance: |
Kitem1(IMPC)Ccpcz page
|
| IMPC: |
Kit gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Czech Centre for Phenogenomics using Cas9 and guides with spacer sequences GCTCGATCCTCCGTGCCCTC and TTGGGTAAACTGGTAAGATC that targeted exon(s) ENSMUSE00001298135.2. This resulted in deletion(s) of 817 bp (location: Chr5:75775519-75776335; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
2 reference(s) |
|