About   Help   FAQ
Hand2em1(IMPC)Rbrc
Endonuclease-mediated Allele Detail
Summary
Symbol: Hand2em1(IMPC)Rbrc
Name: heart and neural crest derivatives expressed 2; endonuclease-mediated mutation 1, RIKEN BioResource Center
MGI ID: MGI:6437756
Gene: Hand2  Location: Chr8:57774018-57777552 bp, + strand  Genetic Position: Chr8, 29.8 cM
Alliance: Hand2em1(IMPC)Rbrc page
IMPC: Hand2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJcl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at RIKEN BioResource Research Center by injecting D10A Protein and 2 guide sequences CTCCTCGTGGCTGCAGCGGCTGG, CGGCTGGCTTATTGGCCACCCGG, which resulted in a Indel. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Hand2 Mutation:  14 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory