Hand2^{em1(IMPC)Rbrc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hand2^{em1(IMPC)Rbrc}
• Name: heart and neural crest derivatives expressed 2; endonuclease-mediated mutation 1, RIKEN BioResource Center
• MGI ID: MGI:6437756
• Gene: Hand2 Location: Chr8:57774018-57777552 bp, + strand Genetic Position: Chr8, 29.8 cM
• Alliance: Hand2^{em1(IMPC)Rbrc} page
• IMPC: Hand2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJcl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at RIKEN BioResource Research Center using D10A and guides with spacer sequences CGGCTGGCTTATTGGCCACC and CTCCTCGTGGCTGCAGCGGC that targeted exon(s) ENSMUSE00000267757.3. This resulted in deletion(s) of 16 bp (location: Chr8:57775064-57775079; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Hand2 Mutation: 14 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)