Kcnc1em4(IMPC)H
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Kcnc1em4(IMPC)H |
| Name: |
potassium voltage gated channel, Shaw-related subfamily, member 1; endonuclease-mediated mutation 4, Harwell |
| MGI ID: |
MGI:6437754 |
| Gene: |
Kcnc1 Location: Chr7:46045921-46088128 bp, + strand Genetic Position: Chr7, 30.1 cM
|
| Alliance: |
Kcnc1em4(IMPC)H page
|
| IMPC: |
Kcnc1 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences AGAAGAACTCGTCGGCACGC and CACGCGGGTCATAGTCGAAG that targeted exon(s) ENSMUSE00001982528.1 ENSMUSE00002200242.1. This resulted in deletion(s) of 7 bp (location: Chr7:46047250-46047256; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
3 reference(s) |
|