Srpx2^{em1(IMPC)Hmgu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Srpx2^{em1(IMPC)Hmgu}
• Name: sushi-repeat-containing protein, X-linked 2; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
• MGI ID: MGI:6435665
• Gene: Srpx2 Location: ChrX:132809175-132833195 bp, + strand Genetic Position: ChrX, 55.47 cM
• Alliance: Srpx2^{em1(IMPC)Hmgu} page
• IMPC: Srpx2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Helmholtz-Zentrum Muenchen using Cas9 and guides with spacer sequences CGATAGAGCAAAGTTCTGAA, CTCGCTGTCCTACAAATGTA, GAATCTACTGGGGACACAAG, and TCCCAGAAACAGGCTTACGT that targeted exon(s) ENSMUSE00000207616.2 ENSMUSE00000207617.2 ENSMUSE00000407441.2. This resulted in deletion(s) of 3210 bp (location: ChrX:132823930-132827139; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Srpx2 Mutation: 5 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)