Ms4a4dem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ms4a4dem1(IMPC)J |
| Name: |
membrane-spanning 4-domains, subfamily A, member 4D; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6432397 |
| Gene: |
Ms4a4d Location: Chr19:11514165-11535831 bp, + strand Genetic Position: Chr19, 8.44 cM, cytoband B
|
| Alliance: |
Ms4a4dem1(IMPC)J page
|
| IMPC: |
Ms4a4d gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATGCTACATTCCCATTTAA and ATGGCGGGATGCCATGGAGG, which resulted in a 6557 bp deletion beginning at Chromosome 19 position 11,548,405 bp and ending after 11,554,961 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000991798, ENSMUSE00000985830, ENSMUSE00001086305, ENSMUSE00000144349 (exons 2,3,4,5) and 6097 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. There is a 3 bp deletion (ATT) 24 bp before the larger deletion.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|