About   Help   FAQ
Crmp1em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
Summary
Symbol: Crmp1em1(IMPC)Mbp
Name: collapsin response mediator protein 1; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6430667
Synonyms: Crmp1-
Gene: Crmp1  Location: Chr5:37399402-37449507 bp, + strand  Genetic Position: Chr5, 19.96 cM
Alliance: Crmp1em1(IMPC)Mbp page
IMPC: Crmp1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences GCATTCGAATATTAGATAGCAGG, CCCTACCACGATAAATATAGATC, which resulted in an exon deletion. Exon 3 was deleted causing a frameshift that is predicted to generate an early stop codon after the amino acid in position 40. Whole-mount staining of cochlear explants using a primary anti-CRMP1 antibody demonstrated the absence of protein in the cochlear epithelium at P5. (J:265051, J:324253)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Crmp1 Mutation:  45 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/07/2026
MGI 6.24
The Jackson Laboratory