Tmc5^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmc5^em1(IMPC)J
• Name: transmembrane channel-like gene family 5; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6423085
• Gene: Tmc5 Location: Chr7:118196520-118274308 bp, + strand Genetic Position: Chr7, 63.44 cM, cytoband F3
• Alliance: Tmc5^em1(IMPC)J page
• IMPC: Tmc5 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTCACTCAGTGATAATGAA and TGATGTGCATTACACCCTGG, which resulted in a 2287 bp deletion beginning at Chromosome 7 position 118,647,495 bp and ending after 118,649,781 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000408830, ENSMUSE00000351147 (exons 6,7) and 1986 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 298 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tmc5 Mutation: 44 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)