About   Help   FAQ
Rexo1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rexo1em1(IMPC)J
Name: REX1, RNA exonuclease 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6414770
Gene: Rexo1  Location: Chr10:80376756-80397394 bp, - strand  Genetic Position: Chr10, 39.72 cM, cytoband C1
Alliance: Rexo1em1(IMPC)J page
IMPC: Rexo1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTATGAGAGGAAGCAGCGCT and CATTGCCGCCAGACCCTACG, which resulted in a 917 bp deletion beginning at Chromosome 10 position 80,547,705 bp and ending after 80,548,621 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001237652 and ENSMUSE00001289454 (exons 3 and 4) and 601 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 632 and early truncation 24 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 8 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rexo1 Mutation:  36 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory