Ttyh3^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ttyh3^em1(IMPC)Tcp
• Name: tweety family member 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6414563
• Gene: Ttyh3 Location: Chr5:140606333-140634786 bp, - strand Genetic Position: Chr5, 79.16 cM
• Alliance: Ttyh3^em1(IMPC)Tcp page
• IMPC: Ttyh3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at The Centre for Phenogenomics by injecting CAS9 Protein and 2 guide sequences CCCACGGGGATTCTTGCTATGAT, CCCTGTGTCGTGTCAGGTGGCAC, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ttyh3 Mutation: 20 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)