Eny2em1(IMPC)Bay
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Eny2em1(IMPC)Bay |
| Name: |
ENY2 transcription and export complex 2 subunit; endonuclease-mediated mutation 1, Baylor College of Medicine |
| MGI ID: |
MGI:6414562 |
| Synonyms: |
Eny2- |
| Gene: |
Eny2 Location: Chr15:44291488-44301652 bp, + strand Genetic Position: Chr15, 16.91 cM
|
| Alliance: |
Eny2em1(IMPC)Bay page
|
| IMPC: |
Eny2 gene page |
|
Eny2em1(IMPC)Bay/Eny2em1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E3.5 as early blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida and form irregular outgrowths with no obvious inner cell mass colony or trophoblast giant cells.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences ACAGCTGGAGAATATTACCC, GAACTGTGTTTAATTACCTC, TTAGGTACATAAGTGCTTAA, and TTGTGTCATTAGAGCAAATT that targeted exon(s) ENSMUSE00000125683.2 ENSMUSE00001430099.2 ENSMUSE00002023755.1. This resulted in deletion(s) of 624 bp (location: Chr15:44292694-44293317; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
5 reference(s) |
|