Tbcbem1(IMPC)Bay
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tbcbem1(IMPC)Bay |
| Name: |
tubulin folding cofactor B; endonuclease-mediated mutation 1, Baylor College of Medicine |
| MGI ID: |
MGI:6414554 |
| Synonyms: |
Tbcb- |
| Gene: |
Tbcb Location: Chr7:29923554-29931622 bp, - strand Genetic Position: Chr7, 17.33 cM
|
| Alliance: |
Tbcbem1(IMPC)Bay page
|
| IMPC: |
Tbcb gene page |
|
Tbcbem1(IMPC)Bay/Tbcbem1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida but form irregular outgrowths in culture.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences AGGTGGTTGAGGTTACGTTG and TGTCGTGACCCGGATGATCC that targeted exon(s) ENSMUSE00000247285.4 ENSMUSE00002063905.1 ENSMUSE00002063918.1 ENSMUSE00002063920.1. This resulted in deletion(s) of 611 bp (location: Chr7:29926803-29927413; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
5 reference(s) |
|