Trmt5^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trmt5^em1(IMPC)Bay
• Name: TRM5 tRNA methyltransferase 5; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6414539
• Synonyms: Trmt5^-
• Gene: Trmt5 Location: Chr12:73326785-73333484 bp, - strand Genetic Position: Chr12, 30.42 cM, cytoband D1
• Alliance: Trmt5^em1(IMPC)Bay page
• IMPC: Trmt5 gene page

Trmt5^em1(IMPC)Bay/Trmt5^em1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida and form normal outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences GAGTTCTTCACAATGAAGTG and GTTAGAATGATCACTGTCCC that targeted exon(s) ENSMUSE00000298244.2 ENSMUSE00002097041.1 ENSMUSE00000298250.2 ENSMUSE00000351096.4. This resulted in deletion(s) of 4 bp (location: Chr12:73327676-73327679; GRCm39), 722 bp (location: Chr12:73327758-73328479; GRCm39), and 3740 bp (location: Chr12:73328486-73332225; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Trmt5 Mutation: 15 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 5 reference(s)