Pms2^{em1(IMPC)Ccpcz}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pms2^{em1(IMPC)Ccpcz}
• Name: PMS1 homolog2, mismatch repair system component; endonuclease-mediated mutation 1, Institute of Molecular Genetics
• MGI ID: MGI:6414532
• Gene: Pms2 Location: Chr5:143846782-143870786 bp, + strand Genetic Position: Chr5, 82.82 cM, cytoband G2
• Alliance: Pms2^{em1(IMPC)Ccpcz} page
• IMPC: Pms2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Czech Centre for Phenogenomics using Cas9 and guides with spacer sequences ACGAAGTGCTTTGAGACAGG and TTAGCTCATTATGTATGGTC that targeted exon(s) ENSMUSE00001286041.2. This resulted in deletion(s) of 22 bp (location: Chr5:143850749-143850770; GRCm39), 1213 bp (location: Chr5:143850774-143851986; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pms2 Mutation: 52 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)