Lsm2em1(IMPC)Bay
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Lsm2em1(IMPC)Bay |
| Name: |
LSM2 homolog, U6 small nuclear RNA and mRNA degradation associated; endonuclease-mediated mutation 1, Baylor College of Medicine |
| MGI ID: |
MGI:6414498 |
| Synonyms: |
Lsm2- |
| Gene: |
Lsm2 Location: Chr17:35200838-35204867 bp, + strand Genetic Position: Chr17, 18.52 cM
|
| Alliance: |
Lsm2em1(IMPC)Bay page
|
| IMPC: |
Lsm2 gene page |
|
Lsm2em1(IMPC)Bay/Lsm2em1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts in vitro hatch from the zona pellucida and form irregular outgrowths.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 4 guide sequences TCTTAACGATTCAGGAGTTGGGG, CCCGTTTAACGGATTGTTGTTGG, ATGCTTAAATGCTGTACCACTGG, AAGTTTTGAGAACTACTAGGAGG, which resulted in a Exon Deletion.
(J:265051)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
4 reference(s) |
|