About   Help   FAQ
Cmtm8em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cmtm8em1(IMPC)J
Name: CKLF-like MARVEL transmembrane domain containing 8; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6407416
Gene: Cmtm8  Location: Chr9:114618411-114673220 bp, - strand  Genetic Position: Chr9, 65.2 cM
Alliance: Cmtm8em1(IMPC)J page
IMPC: Cmtm8 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAAATGTAATCTCAAATGT and ATAATATGTACAGGTTGTGT, which resulted in a 6990 bp deletion beginning at Chromosome 9 position 114,789,313 bp and ending after 114,796,302 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000329345, ENSMUSE00000329328 and ENSMUSE00000359329 (exons 2,3 and 4) and 6298 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 58 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cmtm8 Mutation:  6 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory