About   Help   FAQ
Cep85lem1Ciphe
Endonuclease-mediated Allele Detail
Summary
Symbol: Cep85lem1Ciphe
Name: centrosomal protein 85-like; endonuclease-mediated mutation 1, Centre d'ImmunoPhenomique
MGI ID: MGI:6406984
Gene: Cep85l  Location: Chr10:53149539-53256043 bp, - strand  Genetic Position: Chr10, 27.09 cM
Alliance: Cep85lem1Ciphe page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExon 1 and intron 1 were targeted with sgRNAs (targeting CCAGAAGCCGAGGCGACCGCGGG and TCTCCGGAGTCCGCGCCCTAAGG) using CRISPR/Cas9 technology, resulting in a 174 bp deletion which includes the start of the CDS at the 3' end of exon 1. (J:82809, J:282407)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Cep85l Mutation:  48 strains or lines available
References
Original:  J:82809 European Mouse Mutant Archive, Information obtained from the European Mouse Mutant Archive (EMMA). Unpublished. 2003-2013;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory