Cep85l^em1Ciphe
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cep85l^em1Ciphe
• Name: centrosomal protein 85-like; endonuclease-mediated mutation 1, Centre d'ImmunoPhenomique
• MGI ID: MGI:6406984
• Gene: Cep85l Location: Chr10:53149539-53256043 bp, - strand Genetic Position: Chr10, 27.09 cM
• Alliance: Cep85l^em1Ciphe page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 1 and intron 1 were targeted with sgRNAs (targeting CCAGAAGCCGAGGCGACCGCGGG and TCTCCGGAGTCCGCGCCCTAAGG) using CRISPR/Cas9 technology, resulting in a 174 bp deletion which includes the start of the CDS at the 3' end of exon 1. (J:82809, J:282407)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cep85l Mutation: 48 strains or lines available

References

• Original: J:82809 European Mouse Mutant Archive, Information obtained from the European Mouse Mutant Archive (EMMA). Unpublished. 2003-2013
• All: 2 reference(s)