About   Help   FAQ
Zscan29em1Ciphe
Endonuclease-mediated Allele Detail
Summary
Symbol: Zscan29em1Ciphe
Name: zinc finger SCAN domains 29; endonuclease-mediated mutation 1, Centre d'ImmunoPhenomique
MGI ID: MGI:6406851
Gene: Zscan29  Location: Chr2:120988754-121001606 bp, - strand  Genetic Position: Chr2, 60.37 cM
Alliance: Zscan29em1Ciphe page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExon 1 and the exon1-intron 1 boundary were targeted with sgRNAs (targeting TATGGGAACTTTGCTGTCGGTGG and GACCTGGACATTCGGTGAGGAGG) using CRISPR/Cas9 technology, resulting in a 227 bp deletion encompassing the 3' part of the CDS in exon 1. (J:82809)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Zscan29 Mutation:  36 strains or lines available
References
Original:  J:82809 European Mouse Mutant Archive, Information obtained from the European Mouse Mutant Archive (EMMA). Unpublished. 2003-2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory