Zscan29^em1Ciphe
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zscan29^em1Ciphe
• Name: zinc finger SCAN domains 29; endonuclease-mediated mutation 1, Centre d'ImmunoPhenomique
• MGI ID: MGI:6406851
• Gene: Zscan29 Location: Chr2:120988754-121001606 bp, - strand Genetic Position: Chr2, 60.37 cM
• Alliance: Zscan29^em1Ciphe page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 1 and the exon1-intron 1 boundary were targeted with sgRNAs (targeting TATGGGAACTTTGCTGTCGGTGG and GACCTGGACATTCGGTGAGGAGG) using CRISPR/Cas9 technology, resulting in a 227 bp deletion encompassing the 3' part of the CDS in exon 1. (J:82809)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zscan29 Mutation: 36 strains or lines available

References

• Original: J:82809 European Mouse Mutant Archive, Information obtained from the European Mouse Mutant Archive (EMMA). Unpublished. 2003-2013
• All: 1 reference(s)