Arap1^em1Ciphe
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arap1^em1Ciphe
• Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1; endonuclease-mediated mutation 1, Centre d'ImmunoPhenomique
• MGI ID: MGI:6406675
• Gene: Arap1 Location: Chr7:100997296-101061793 bp, + strand Genetic Position: Chr7, 54.56 cM, cytoband F1
• Alliance: Arap1^em1Ciphe page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Intron 19 and exon 21 were targeted with sgRNAs (targeting TATGGGTCATGAATAAGGCCTGG and TGTACATCCAGGGTGAGCGGCGG) using CRISPR/Cas9 technology, resulting in a 222bp deletion encompassing exon 20 and a 5' part of exon 21. (J:82809, J:282407)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Arap1 Mutation: 77 strains or lines available

References

• Original: J:82809 European Mouse Mutant Archive, Information obtained from the European Mouse Mutant Archive (EMMA). Unpublished. 2003-2013
• All: 2 reference(s)