About   Help   FAQ
Rnpepem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rnpepem1(IMPC)J
Name: arginyl aminopeptidase (aminopeptidase B); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6406455
Gene: Rnpep  Location: Chr1:135190447-135211765 bp, - strand  Genetic Position: Chr1, 58.43 cM
Alliance: Rnpepem1(IMPC)J page
IMPC: Rnpep gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCTCCTTGAGGCTGCTAAA and TCCCGGGTGAGGTTTCCCCT, which resulted in a 5393 bp deletion beginning at Chromosome 1 position 135,272,191 bp and ending after 135,277,583 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000241626 and ENSMUSE00000241618 (exons 3 and 4) and 5127 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence and early truncation after amino acid 197. (J:188991, J:384794)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rnpep Mutation:  28 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory