Rnpep^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rnpep^em1(IMPC)J
• Name: arginyl aminopeptidase (aminopeptidase B); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6406455
• Gene: Rnpep Location: Chr1:135190447-135211765 bp, - strand Genetic Position: Chr1, 58.43 cM
• Alliance: Rnpep^em1(IMPC)J page
• IMPC: Rnpep gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCTCCTTGAGGCTGCTAAA and TCCCGGGTGAGGTTTCCCCT, which resulted in a 5393 bp deletion beginning at Chromosome 1 position 135,272,191 bp and ending after 135,277,583 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000241626 and ENSMUSE00000241618 (exons 3 and 4) and 5127 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence and early truncation after amino acid 197. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rnpep Mutation: 28 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)