Rnpepem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Rnpepem1(IMPC)J |
Name: |
arginyl aminopeptidase (aminopeptidase B); endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6406455 |
Gene: |
Rnpep Location: Chr1:135190450-135211822 bp, - strand Genetic Position: Chr1, 58.43 cM
|
Alliance: |
Rnpepem1(IMPC)J page
|
IMPC: |
Rnpep gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCTCCTTGAGGCTGCTAAA and TCCCGGGTGAGGTTTCCCCT, which resulted in a 5393 bp deletion beginning at Chromosome 1 position 135,272,191 bp and ending after 135,277,583 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000241626 and ENSMUSE00000241618 (exons 3 and 4) and 5127 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence and early truncation after amino acid 197.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|