About   Help   FAQ
Clec2gem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Clec2gem1(IMPC)J
Name: C-type lectin domain family 2, member g; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6406445
Gene: Clec2g  Location: Chr6:128911344-128961670 bp, + strand  Genetic Position: Chr6, 63.11 cM, cytoband F3
Alliance: Clec2gem1(IMPC)J page
IMPC: Clec2g gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTCTGTGGTCTGGACAGTTC and TGTGTCGTGGCTATGAGAGA, which resulted in a 1135 bp deletion beginning at Chromosome 6 position 128,980,911 bp and ending after 128,982,045 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000967171 and ENSMUSE00001067493 (exons 5 and 6) and 849 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 127 and early truncation 12 amino acids later. There is a 9 base pair insertion (ACAATGCAC) at the deletion site. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Clec2g Mutation:  24 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory