Clec2gem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Clec2gem1(IMPC)J |
| Name: |
C-type lectin domain family 2, member g; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6406445 |
| Gene: |
Clec2g Location: Chr6:128911344-128961670 bp, + strand Genetic Position: Chr6, 63.11 cM, cytoband F3
|
| Alliance: |
Clec2gem1(IMPC)J page
|
| IMPC: |
Clec2g gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences CTCTGTGGTCTGGACAGTTC and TGTGTCGTGGCTATGAGAGA that targeted exon(s) ENSMUSE00000967171.2 ENSMUSE00001067493.2. This resulted in deletion(s) of 19 bp (location: Chr6:128957874-128957892; GRCm39), 1113 bp (location: Chr6:128957897-128959009; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|