Nifk^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nifk^em1(IMPC)Mbp
• Name: nucleolar protein interacting with the FHA domain of MKI67; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6404513
• Synonyms: Nifk^-
• Gene: Nifk Location: Chr1:118249569-118261552 bp, + strand Genetic Position: Chr1, 52.14 cM
• Alliance: Nifk^em1(IMPC)Mbp page
• IMPC: Nifk gene page

Nifk^em1(IMPC)Mbp/Nifk^em1(IMPC)Mbp mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 appear as dying morulae. Mutants fail to hatch from the zona pellucida and are dead after 72hr in vitro, never forming outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences CAACTTACACGTGCATCTGT and TATTTGGCACACACCAGCGA that targeted exon(s) ENSMUSE00000235698.2. This resulted in deletion(s) of 2 bp (location: Chr1:118256377-118256378; GRCm39), 8 bp (location: Chr1:118256091-118256098; GRCm39), 389 bp (location: Chr1:118256397-118256785; GRCm39), and 622 bp (location: Chr1:118255014-118255635; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nifk Mutation: 16 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 5 reference(s)