Dhx34em1(IMPC)Bay
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Dhx34em1(IMPC)Bay |
| Name: |
DExH-box helicase 34; endonuclease-mediated mutation 1, Baylor College of Medicine |
| MGI ID: |
MGI:6404490 |
| Gene: |
Dhx34 Location: Chr7:15931145-15956005 bp, - strand Genetic Position: Chr7, 8.76 cM, cytoband A2
|
| Alliance: |
Dhx34em1(IMPC)Bay page
|
| IMPC: |
Dhx34 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences GAAGTCGCCACGGTTCTGCT and TGGGGCAAGGCTATCTAGAA that targeted exon(s) ENSMUSE00000198032.4 ENSMUSE00000198041.5 ENSMUSE00000198043.4 ENSMUSE00002089148.1. This resulted in deletion(s) of 2558 bp (location: Chr7:15948034-15950591; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Dhx34 Mutation: |
36 strains or lines available
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
4 reference(s) |
|