About   Help   FAQ
Tifabem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tifabem1(IMPC)J
Name: TRAF-interacting protein with forkhead-associated domain, family member B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6404191
Gene: Tifab  Location: Chr13:56321517-56326698 bp, - strand  Genetic Position: Chr13, 30.06 cM
Alliance: Tifabem1(IMPC)J page
IMPC: Tifab gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGCCTTGGGTCTGTAAATC and GAGCCTGTACCACCCTACAC, which resulted in a 368 bp deletion beginning at Chromosome 13 position 56,176,215 bp and ending after 56,176,582 bp (GRCm38/mm10). This mutation deletes 368 bp from ENSMUSE00001037023 (exon 3) and is predicted to cause a change of amino acid sequence after residue 15 and early truncation 17 amino acids later. There is a 4 bp insertion (GGCT) at the deletion site. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tifab Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory