Ptpn18em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Ptpn18em1(IMPC)J |
Name: |
protein tyrosine phosphatase, non-receptor type 18; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6403887 |
Gene: |
Ptpn18 Location: Chr1:34498843-34514814 bp, + strand Genetic Position: Chr1, 13.25 cM
|
Alliance: |
Ptpn18em1(IMPC)J page
|
IMPC: |
Ptpn18 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGGGATCCTGCAATTTAAG and GCTACCGATTTCCCTTCCCG, which resulted in a 1972 bp deletion beginning at Chromosome 1 position 34,471,279 bp and ending after 34,473,250 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000966996, ENSMUSE00001013859, ENSMUSE00000972361, ENSMUSE00000972732, and ENSMUSE00001085919 (exons 9-13) and 1442 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 230 and early truncation 9 amino acids later. There is a 12 bp (GCACCCATTGCA) insertion at the deletion site.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|