About   Help   FAQ
Pop5em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pop5em1(IMPC)J
Name: processing of precursor 5, ribonuclease P/MRP family (S. cerevisiae); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6403854
Synonyms: Pop5-
Gene: Pop5  Location: Chr5:115373505-115379031 bp, + strand  Genetic Position: Chr5, 56.01 cM
Alliance: Pop5em1(IMPC)J page
IMPC: Pop5 gene page
Pop5em1(IMPC)J/Pop5em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 appear as uncompacted morula. Mutants fail to hatch from the zona pellucida and are dead after 72 hr in vitro, never forming blastocysts.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGATTTCGACAGTTTTGTGG and GCGTTTTGTACGATAGTGGA, which resulted in a 611 bp deletion beginning at Chromosome 5 position 115,237,751 bp and ending after 115,238,361 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000519136, ENSMUSE00000465080 (exons 2 and 3) and 222 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pop5 Mutation:  16 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory