Pop5^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pop5^em1(IMPC)J
• Name: processing of precursor 5, ribonuclease P/MRP family (S. cerevisiae); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6403854
• Synonyms: Pop5^-
• Gene: Pop5 Location: Chr5:115373505-115379031 bp, + strand Genetic Position: Chr5, 56.01 cM
• Alliance: Pop5^em1(IMPC)J page
• IMPC: Pop5 gene page

Pop5^em1(IMPC)J/Pop5^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 appear as uncompacted morula. Mutants fail to hatch from the zona pellucida and are dead after 72 hr in vitro, never forming blastocysts.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences GCGTTTTGTACGATAGTGGA and GGATTTCGACAGTTTTGTGG that targeted exon(s) ENSMUSE00000465080.3 ENSMUSE00000519136.2. This resulted in deletion(s) of 611 bp (location: Chr5:115375810-115376420; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pop5 Mutation: 16 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)