Zbtb20^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zbtb20^em1(IMPC)H
• Name: zinc finger and BTB domain containing 20; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6403700
• Gene: Zbtb20 Location: Chr16:42728008-43462981 bp, + strand Genetic Position: Chr16, 28.44 cM, cytoband B4
• Alliance: Zbtb20^em1(IMPC)H page
• IMPC: Zbtb20 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences ACGGTTGCGCTGCTCGTTGA, ACTACCCAACCCGCGGGCAG, GACGTGACGGTTCGCATCCA, and GTGCTTGACGTAGTTCTGTT that targeted exon(s) ENSMUSE00001282621.2 ENSMUSE00001283364.2. This resulted in deletion(s) of 5 bp (location: Chr16:43431259-43431263; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 3 strains available Cell Lines: 0 lines available
• Carrying any Zbtb20 Mutation: 56 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)