Terb1^em1Leim
Endonuclease-mediated Allele Detail

Summary

• Symbol: Terb1^em1Leim
• Name: telomere repeat binding bouquet formation protein 1; endonuclease-mediated mutation 1, Ming Lei
• MGI ID: MGI:6403160
• Synonyms: Terb1^AEA
• Gene: Terb1 Location: Chr8:105173351-105236542 bp, - strand Genetic Position: Chr8, 53.04 cM
• Alliance: Terb1^em1Leim page

Mutation origin

• Strain of Origin: (C57BL/6J x CBA/J)F1

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Nucleotide substitutions
• Mutation details: Using an sgRNA (ACAAAGTTGTCTTCTTCTAC), a donor oligonucleotide (AACTACTTAAATTACTGTTTTAAGTATACTAAATGTTTTTTATATTTTTCAGAAATTTTGGCGGAAGCATGCAGAAGAAGACAACTTTGTAAAGAATCTACTGCCTCTGAAGAACTAAGTAAGTATATT) and CRISPR/Cas9 technology, codons 647-649 were changed from LeuThrPro to AlaGluAla (p.Leu647_Pro649delinsAlaGluAla). This abolishes the telomeric repeat binding factor 1 (Terf1)-binding domain. (J:286164)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Terb1 Mutation: 47 strains or lines available

References

• Original: J:286164 Long J, et al., Telomeric TERB1-TRF1 interaction is crucial for male meiosis. Nat Struct Mol Biol. 2017 Dec;24(12):1073-1080
• All: 1 reference(s)