Diaph1^{em1(IMPC)Rbrc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Diaph1^{em1(IMPC)Rbrc}
• Name: diaphanous related formin 1; endonuclease-mediated mutation 1, RIKEN BioResource Center
• MGI ID: MGI:6402885
• Gene: Diaph1 Location: Chr18:37976654-38068529 bp, - strand Genetic Position: Chr18, 19.71 cM
• Alliance: Diaph1^{em1(IMPC)Rbrc} page
• IMPC: Diaph1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJcl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at RIKEN BioResource Research Center using Cas9 and guides with spacer sequences AAGTACATTACAGTACGGAA and GGGCCAAGTACTGTACTGTA that targeted exon(s) ENSMUSE00000625537.2. This resulted in deletion(s) of 391 bp (location: Chr18:38035012-38035402; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Diaph1 Mutation: 117 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)