About   Help   FAQ
Eid2bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Eid2bem1(IMPC)J
Name: EP300 interacting inhibitor of differentiation 2B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6402774
Gene: Eid2b  Location: Chr7:27977164-27978914 bp, + strand  Genetic Position: Chr7, 16.67 cM
Alliance: Eid2bem1(IMPC)J page
IMPC: Eid2b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCGAGCTTCCCGGAGAGAGC and GGCGTTGGGGCCGCGGGCGT, which resulted in a 432 bp deletion beginning at Chromosome 7 position 28,277,795 bp and ending after 28,278,226 bp (GRCm38/mm10). This mutation deletes 432 bp of ENSMUSE00000597783 (exon 1) and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 9 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Eid2b Mutation:  6 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory