About   Help   FAQ
Il3raem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Il3raem1(IMPC)J
Name: interleukin 3 receptor, alpha chain; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6402757
Gene: Il3ra  Location: Chr14:8114270-8123851 bp, - strand  Genetic Position: Chr14, 7.08 cM
Alliance: Il3raem1(IMPC)J page
IMPC: Il3ra gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACCACTCACCCCAAGTAT and GGTGTAAGATTTGGGAGCAG, which resulted in a 423 bp deletion beginning at Chromosome 14 position 14,348,720 bp and ending after 14,349,142 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000565028 (exon 4) and 299 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 19 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Il3ra Mutation:  37 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory