About   Help   FAQ
Dytnem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dytnem1(IMPC)J
Name: dystrotelin; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6402623
Gene: Dytn  Location: Chr1:63662010-63726086 bp, - strand  Genetic Position: Chr1, 32.31 cM
Alliance: Dytnem1(IMPC)J page
IMPC: Dytn gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGGCTTTTCTTCTATAGCAG and CATTTTTCAGGGCTAACACG, which resulted in a 826 bp deletion beginning at Chromosome 1 position 63,664,040 bp and ending after 63,664,865 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001284352 and ENSMUSE00000601289 (exons 7 and 8) and 590 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 163 and early truncation 7 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dytn Mutation:  30 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/12/2026
MGI 6.24
The Jackson Laboratory