About   Help   FAQ
Tex21em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tex21em1(IMPC)J
Name: testis expressed gene 21; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6401351
Gene: Tex21  Location: Chr12:76245460-76293520 bp, - strand  Genetic Position: Chr12, 33.52 cM, cytoband D2
Alliance: Tex21em1(IMPC)J page
IMPC: Tex21 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTAAGGAGAGAGTTCGGCGT and TTTGAATGAGAGAAATTCAC, which resulted in a 6247 bp deletion beginning at Chromosome 12 position 76,239,314 bp and ending after 76,245,560 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000369176 and ENSMUSE00000284491 (exons 2 and 3) and 5767 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tex21 Mutation:  101 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory