About   Help   FAQ
Zfp729bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp729bem1(IMPC)J
Name: zinc finger protein 729b; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6401338
Gene: Zfp729b  Location: Chr13:67737558-67757767 bp, - strand  Genetic Position: Chr13, 34.59 cM
Alliance: Zfp729bem1(IMPC)J page
IMPC: Zfp729b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCTACAGTTGTGAGATTTG and AATATGGAAAAGTTTTTGAG, which resulted in a 1775 bp deletion beginning at Chromosome 13 position 67,592,123 bp and ending after 67,593,897 bp (GRCm38/mm10). This mutation deletes 1775 bp from ENSMUSE00000465644 (exon 4) and is predicted to cause a change of amino acid sequence after residue 82 and early truncation 6 amino acids later. (J:188991, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp729b Mutation:  43 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/19/2026
MGI 6.24
The Jackson Laboratory