Fahd1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Fahd1em1(IMPC)J |
Name: |
fumarylacetoacetate hydrolase domain containing 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6401314 |
Gene: |
Fahd1 Location: Chr17:25067870-25069276 bp, - strand Genetic Position: Chr17, 12.53 cM
|
Alliance: |
Fahd1em1(IMPC)J page
|
IMPC: |
Fahd1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAGGCTTGTCAGTTCCCTA and TTGGCTGTGAACTCTATGGG, which resulted in a 1932 bp deletion beginning at Chromosome 17 position 24,848,493 bp and ending after 24,850,424 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000343391 (exon 1) and 459 bp of flanking intronic sequence including the splice acceptor, donor and start site. It is predicted to generate a null allele.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|