About   Help   FAQ
Zfp267em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp267em1(IMPC)J
Name: zinc finger protein 267; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6400458
Gene: Zfp267  Location: Chr3:36205233-36224491 bp, + strand  Genetic Position: Chr3, 17.41 cM
Alliance: Zfp267em1(IMPC)J page
IMPC: Zfp267 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCGAGACATTTTAACACAG and GTACCAAGTTAGGAATTCTG, which resulted in a 282 bp deletion beginning at Chromosome 3 position 36,159,387 bp and ending after 36,159,668 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000897231 (exon 2) and 155 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 21 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp267 Mutation:  34 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory